SGCD cloning plasmid

No Image

SGCD cloning plasmid

0.00 out of 0

233.00 EUR

A cloning plasmid for the SGCD gene.
Disponibilità: In ordineNumero di catalogo: CSB-CL835688HU-10ugFornitore: CusabioTaglia: 10ug
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgatgcctcaggagcagtacactcaccaccggagcaccatgcctggctctgtggggccacaggtatacaaggtggggatttacggctggcggaaacgatgcctgtatttctttgtcctgctcctcatgattttaatactggtgaacttggccatgaccatctggattctcaaagtcatgaacttcacaattgatggaatgggaaacctgaggatcacagaaaaaggtctaaagctagaaggagactctgaattcttacaacctctctacgccaaagaaatccagtcccgaccaggtaatgccctgtacttcaagtctgccagaaatgttacagtgaacattctcaatgaccagactaaagtgctaactcagcttataacaggtccaaaagccgtagaagcttatggtaaaaaatttgaggtaaaaactgtttctggaaaattgctcttctctgcagacaataatgaagtggtagtaggagctgaaagattacgagttttaggagcggagggcacagtgttccctaaatctatagaaacacctaatgtcagggcagaccccttcaaagaactaaggttggagtccccaacccggtctctagtgatggaggccccaaaaggagtggaaatcaatgcagaagctggcaatatggaagccacctgcaggacagagctgagactggaatccaaagatggagagattaagttagatgctgcgaaaatcaggctacctagactgcctcatggatcctacacgcctacaggaacgaggcagaaggtcttcgagatctgcgtctgcgccaatgggagattattcctgtctcaggcaggagctgggtccacttgtcagataaacacaagtgtctgcctctga
  • Gene name: SGCD
  • Gene ID: 6444
  • Accession number: BC020740
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. For research use only.

    Related Products:

    Test rapido ad immunofluorescenza per la rilevazione semi-quantitativa degli anticorpi neutralizzanti contro SARS-CoV-2 nel siero umano o nel plasma. Gli anticorpi neutralizzanti sono il più importante marcatore per una possibile immunità. Il Kit Anticorpi Neutralizzanti SARS-CoV-2 è usato per rilevare gli anticorpi neutralizzanti nel siero umano o nel plasma, determinando se il corpo ha ottenuto [...]
    Caratteristiche: Display: 5.0" touch screen Modalità di calibrazione: carta magnetica Senza manutenzione Modalità veloce e standard Rilevazioni veloci: risultati disponibili in 3-15 minuti Tempo di misurazione: 10 secondi Procedura del test: Specifiche tecniche: Principio: Immunofluorescenza Campioni: sangue, plasma, siero Volume del campione: 100 ul Conserva fino a 50.000 risultati Produzione: stampante interna termica Supporta LIS [...]
    tigsun test rapido covid-19
    Test Rapido COVID-19 Tigsun impiega la tecnologia dell'immunocromatografia per rilevare l'antigene SARS-CoV-2 in campioni di secrezioni respiratorie umane. Offre risultati di qualità con prestazioni affidabili in 15 minuti. Non invasivo, veloce e semplice da usare. Confezione da 25 test. Conservare a temperatura ambiente, a 2-30°C fino a 24 mesi dalla data di produzione. Per qualsiasi [...]