LEFTY2 cloning plasmid

0 out of 0
0 recensione del cliente

0.01 EUR

LEFTY2 cloning plasmid
LEFTY2 cloning plasmid

Catalog number: / Dimensione: / Prezzo: EUR (IVA esclusa)

Vai al carrello Vai all'ordine
Inquiry cart
1
Indirizzo Email: | Modifica
2
Dettagli dell'inchiesta
LEFTY2 cloning plasmid
LEFTY2 cloning plasmid

Catalog number: / Dimensione: / Prezzo: EUR (IVA esclusa)

3
Inquiry cart
Disponibilità: Per ordinare Numero di catalogo: CSB-CL012858HU-10ug

Fornitore: Gentaur Taglia: 10ug

Prodotti relativi

Cusabio, CSB-CL012857HU-10ug

LEFTY1 cloning plasmid

Abbexa, 20-abx983368

Mouse LEFTY2 shRNA Plasmid

150 µg 300 µg
Cusabio, CSB-CL012856HU-10ug

LEF1 cloning plasmid

Abbexa, 20-abx983368

Mouse LEFTY2 shRNA Plasmid

150 µg 300 µg
Cusabio, CSB-CL026198HU-10ug

XK cloning plasmid


A cloning plasmid for the LEFTY2 gene.



  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atgtggcccctgtggctctgctgggcactctgggtgctgcccctggctggccccggggcggccctgaccgaggagcagctcctgggcagcctgctgcggcagctgcagctcagcgaggtgcccgtactggacagggccgacatggagaagctggtcatccccgcccacgtgagggcccagtatgtagtcctgctgcggcgcagccacggggaccgctcccgcggaaagaggttcagccagagcttccgagaggtggccggcaggttcctggcgtcggaggccagcacacacctgctggtgttcggcatggagcagcggctgccgcccaacagcgagctggtgcaggccgtgctgcggctcttccaggagccggtccccaaggccgcgctgcacaggcacgggcggctgtccccgcgcagcgcccaggcccgggtgaccgtcgagtggctgcgcgtccgcgacgacggctccaaccgcacctccctcatcgactccaggctggtgtccgtccacgagagcggctggaaggccttcgacgtgaccgaggccgtgaacttctggcagcagctgagccggccccggcagccgctgctgctacaggtgtcggtgcagagggagcatctgggcccgctggcgtccggcgcccacaagctggtccgctttgcctcgcagggggcgccagccgggcttggggagccccagctggagctgcacaccctggacctcagggactatggagctcagggcgactgtgaccctgaagcaccaatgaccgagggcacccgctgctgccgccaggagatgtacattgacctgcaggggatgaagtgggccaagaactgggtgctggagcccccgggcttcctggcttacgagtgtgtgggcacctgccagcagcccccggaggccctggccttcaattggccatttctggggccgcgacagtgtatcgcctcggagactgcctcgctgcccatgatcgtcagcatcaaggagggaggcaggaccaggccccaggtggtcagcctgcccaacatgagggtgcagaagtgcagctgtgcctcggatggggcgctcgtgccaaggaggctccagccatag


Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.


  • Gene name: LEFTY2
  • Gene ID: 7044
  • Accession number: BC035718
  • Vector: pUC

For research use only.

0 recensione per LEFTY2 cloning plasmid

Aggiungi una recensione

12345

☆ ☆ ☆ ☆ ☆  (0)

SPEDIZIONE & RESO GRATUITI*

GARANZIA DI RIMBORSO

SUPPORTO ONLINE
GenTarget, LVP1130-RP

hTERT (CMV, RFP-Puro) lentivirus

527.50EUR 1x107 IFU/ml x 200ul
Lampire Biologicals Laboratories, 7234901-50ML

PORCINE BLOOD, DEFIBRINATED, 50 ML

390.57EUR 1ML
ELK Biotech, ELK1537-96T

HumanSIRT2(Sirtuin2)ELISAKit

1110.50EUR 96T
ScyTek Laboratories, CBB999

Citrate Buffer (10x) pH 6.0

349.88EUR 1000 ml

Printgraph – Sistema di documentazione di gel (SDG)

Gel Eye – Sistema di documentazione di gel (SDG) Gel Eye – Sistema di documentazione di Gel (SDG) Vantaggi del sistema Gel Eye: Un software intelligente GelView per scattare e analizzare le foto in tempo reale Meccanismo automatizzato di spegnere la luce UV che contribuisce alla sicurezza dell’utente. Detezione e analisi quantitativi della fluorescenza automatizzati...
Prigrow X Series Medium for T9305

Prigrow X Series Medium per T9305

Prigrow X Series Medium per T9305 la coltura di cellule di mammifero è composta da formulazioni specifiche di alta qualità per la crescita ottimale di diversi tipi di cellule primarie. Forma: soluzione Torbidità: chiaroSolo per uso di ricerca e non per applicazioni terapeutiche o diagnostiche. I prodotti abm sono destinati esclusivamente a scopi di ricerca...
Puntali con filtro PCR

Puntali con filtro PCR

I nostri puntali filtranti per PCR sono progettati per adattarsi a quasi tutti i tipi di pipette. Sono prodotti con materiali di altissima qualità in un ambiente sterile, assicurando che siano privi di contaminanti che possono influenzare i tuoi risultati. Non tutte le punte sono uguali, e siamo orgogliosi dell'alto standard che abbiamo creato utilizzando...